zgc:112300

Ensembl ID:
ENSDARG00000052016
ZFIN ID:
ZDB-GENE-050913-25
Description:
calcium-binding protein 2 [Source:RefSeq peptide;Acc:NP_001025439]
Human Orthologues:
CABP2, CABP4
Human Descriptions:
calcium binding protein 2 [Source:HGNC Symbol;Acc:1385]
calcium binding protein 4 [Source:HGNC Symbol;Acc:1386]
Mouse Orthologues:
Cabp2, Cabp4
Mouse Descriptions:
calcium binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:1352749]
calcium binding protein 4 Gene [Source:MGI Symbol;Acc:MGI:1920910]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32735 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32735
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073742 Essential Splice Site 131 225 4 8
Genomic Location (Zv9):
Chromosome 1 (position 44713277)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 43436232
GRCz11 1 44137535
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGCTACATGCCTACAGAAATGGAGCTGATTGAACTTAGTCAGCAGATTT[G/A]TAAGTGACAAACTTATCTTATGAGTGTTTTTCTAAAGGACATAATTCATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link