zgc:66449

Ensembl ID:
ENSDARG00000051959
ZFIN ID:
ZDB-GENE-030131-5618
Description:
hypothetical protein LOC327407 [Source:RefSeq peptide;Acc:NP_956095]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24643 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24643
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073679 Essential Splice Site None 334 2 7
ENSDART00000114247 Essential Splice Site 24 360 3 8
ENSDART00000146851 Essential Splice Site None 201 3 5
Genomic Location (Zv9):
Chromosome 25 (position 17945273)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17489137
GRCz11 25 17585537
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGTCTTAATTGAGCTCCATTTTAAATATGAATCATAATTTGTTTTCCA[G/A]TCACAGCAATGAACGTGACGTGTGGCAAAGACTTCATTTCCATCCTAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link