ugt2a4

Ensembl ID:
ENSDARG00000051940
ZFIN IDs:
ZDB-GENE-080721-20, ZDB-GENE-080721-20, ZDB-GENE-080721-21, ZDB-GENE-080721-21, ZDB-GENE-080721-22, ZDB-GENE-080721-23
Description:
UDP glucuronosyltransferase 2 family, polypeptide A3 precursor [Source:RefSeq peptide;Acc:NP_001170
Human Orthologues:
UGT2A1, UGT2A3, UGT2B10, UGT2B11, UGT2B15, UGT2B17, UGT2B28, UGT2B4, UGT2B7
Human Descriptions:
UDP glucuronosyltransferase 2 family, polypeptide A1 [Source:HGNC Symbol;Acc:12542]
UDP glucuronosyltransferase 2 family, polypeptide A3 [Source:HGNC Symbol;Acc:28528]
UDP glucuronosyltransferase 2 family, polypeptide B10 [Source:HGNC Symbol;Acc:12544]
UDP glucuronosyltransferase 2 family, polypeptide B11 [Source:HGNC Symbol;Acc:12545]
UDP glucuronosyltransferase 2 family, polypeptide B15 [Source:HGNC Symbol;Acc:12546]
UDP glucuronosyltransferase 2 family, polypeptide B17 [Source:HGNC Symbol;Acc:12547]
UDP glucuronosyltransferase 2 family, polypeptide B28 [Source:HGNC Symbol;Acc:13479]
UDP glucuronosyltransferase 2 family, polypeptide B4 [Source:HGNC Symbol;Acc:12553]
UDP glucuronosyltransferase 2 family, polypeptide B7 [Source:HGNC Symbol;Acc:12554]
Mouse Orthologues:
Ugt2a1, Ugt2a3, Ugt2b1, Ugt2b34, Ugt2b35, Ugt2b36, Ugt2b37, Ugt2b38, Ugt2b5
Mouse Descriptions:
UDP glucuronosyltransferase 2 family, polypeptide A1 Gene [Source:MGI Symbol;Acc:MGI:2149905]
UDP glucuronosyltransferase 2 family, polypeptide A3 Gene [Source:MGI Symbol;Acc:MGI:1919344]
UDP glucuronosyltransferase 2 family, polypeptide B1 Gene [Source:MGI Symbol;Acc:MGI:1919023]
UDP glucuronosyltransferase 2 family, polypeptide B34 Gene [Source:MGI Symbol;Acc:MGI:2140962]
UDP glucuronosyltransferase 2 family, polypeptide B35 Gene [Source:MGI Symbol;Acc:MGI:3576100]
UDP glucuronosyltransferase 2 family, polypeptide B36 Gene [Source:MGI Symbol;Acc:MGI:3576103]
UDP glucuronosyltransferase 2 family, polypeptide B37 Gene [Source:MGI Symbol;Acc:MGI:2148239]
UDP glucuronosyltransferase 2 family, polypeptide B38 Gene [Source:MGI Symbol;Acc:MGI:2140794]
UDP glucuronosyltransferase 2 family, polypeptide B5 Gene [Source:MGI Symbol;Acc:MGI:98900]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7577 Missense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa7577
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034639   None 543 None 6
ENSDART00000035961   None 359 None 4
ENSDART00000073668   None 533 None 6
ENSDART00000097357   None 532 None 6
ENSDART00000124954 Missense 180 533 1 6
ENSDART00000127782   None 534 None 6
Genomic Location (Zv9):
Chromosome 5 (position 72963850)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 69161446
GRCz11 5 69933998
KASP Assay ID:
554-4349.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGTCATCTCTCTTCGGTTAACTTTCGCGTATACTTTTGAGAGGATGTG[T/G]GGTCAGATGCCCGCTCCTCCGTCTTATGTTCCTGCAGTGGCTCTGACAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link