zgc:111982

Ensembl ID:
ENSDARG00000051920
ZFIN ID:
ZDB-GENE-050417-342
Description:
hypothetical protein LOC550506 [Source:RefSeq peptide;Acc:NP_001017808]
Human Orthologues:
NSMAF, WDFY3
Human Descriptions:
neutral sphingomyelinase (N-SMase) activation associated factor [Source:HGNC Symbol;Acc:8017]
WD repeat and FYVE domain containing 3 [Source:HGNC Symbol;Acc:20751]
Mouse Orthologue:
Nsmaf
Mouse Description:
neutral sphingomyelinase (N-SMase) activation associated factor Gene [Source:MGI Symbol;Acc:MGI:1341

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41052 Essential Splice Site Mutation detected in F1 DNA During 2018
sa34207 Essential Splice Site Mutation detected in F1 DNA During 2018
sa34206 Essential Splice Site Mutation detected in F1 DNA During 2018
sa9529 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41052
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073635 Essential Splice Site 144 911 7 31
Genomic Location (Zv9):
Chromosome 7 (position 59417040)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 57869649
GRCz11 7 58172089
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTGGGGTCACCCATTAAAACTGAAGATGTGGTTCAGATTTTATTACAG[G/A]TTTGCCATTATTCTTTCTTTAGGTTTTTAATTTTTATTGGGAATTTTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34207
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073635 Essential Splice Site 625 911 22 31
Genomic Location (Zv9):
Chromosome 7 (position 59401175)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 57853784
GRCz11 7 58156224
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAACATGAACAAACTTGTCTTGCAGTCTTGCCATAAAATACACAAAGAG[T/C]GAGTATTTGTTTGTCCACTTGAGAACTGATGTAAAGAATAATTACAGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34206
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073635 Essential Splice Site 645 911 23 31
Genomic Location (Zv9):
Chromosome 7 (position 59400990)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 57853599
GRCz11 7 58156039
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCGTTGCTGTGACCCTCAGTGGAGATTCCATCTTCACAACATCCCAAGG[T/C]TAGGAATTCCTCAGTTATTTGGTCTCTTAAGTAAAATGATCACTGACTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9529
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073635 Nonsense 756 911 27 31
Genomic Location (Zv9):
Chromosome 7 (position 59398007)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 57850616
GRCz11 7 58153056
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCCAGTAATAAAAGGACTCARTTTGACCCACTTGCTGAATTTGAGCAT[G/T]AGGCCGGGGTTAGTAAWAAGGAATCCTTAAAAAAAAAAAAMCNNTCAAATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link