slc14a2

Ensembl ID:
ENSDARG00000051914
ZFIN ID:
ZDB-GENE-030131-4833
Description:
Facilitated urea transporterZgc:136632 [Source:UniProtKB/TrEMBL;Acc:Q533H0]
Human Orthologues:
SLC14A1, SLC14A2
Human Descriptions:
solute carrier family 14 (urea transporter), member 1 (Kidd blood group) [Source:HGNC Symbol;Acc:109
solute carrier family 14 (urea transporter), member 2 [Source:HGNC Symbol;Acc:10919]
Mouse Orthologues:
Slc14a1, Slc14a2
Mouse Descriptions:
solute carrier family 14 (urea transporter), member 1 Gene [Source:MGI Symbol;Acc:MGI:1351654]
solute carrier family 14 (urea transporter), member 2 Gene [Source:MGI Symbol;Acc:MGI:1351653]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7006 Nonsense Mutation detected in F1 DNA During 2018
sa20532 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7006
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073626 Nonsense 20 261 2 7
Genomic Location (Zv9):
Chromosome 5 (position 54987132)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 51521642
GRCz11 5 52168235
KASP Assay ID:
554-5107.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCAATGTTTTAATAGAARAGTGACCCGCTGAATGTCACACATCTCTGC[A/T]AAACGTCTACTTCTACACAATATTCCAGTGCTCAAAACACAAAGGTGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20532
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073626 Nonsense 150 261 4 7
Genomic Location (Zv9):
Chromosome 5 (position 54988433)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 51522934
GRCz11 5 52169527
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGCTTTGTTGGAACCTTGTTTGCTACGATTTCTGCACTCATCCTCTGT[C/T]AGAACAGGTATTAACACAACTGGTCAATTATGAATGTCTAAATGTTTGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link