zgc:153062

Ensembl ID:
ENSDARG00000051891
ZFIN ID:
ZDB-GENE-060929-300
Description:
Radial spoke head 10 homolog B [Source:UniProtKB/Swiss-Prot;Acc:Q08CH7]
Human Orthologues:
RSPH10B, RSPH10B2
Human Descriptions:
radial spoke head 10 homolog B (Chlamydomonas) [Source:HGNC Symbol;Acc:27362]
radial spoke head 10 homolog B2 (Chlamydomonas) [Source:HGNC Symbol;Acc:34385]
Mouse Orthologue:
Rsph10b2
Mouse Description:
radial spoke head 10 homolog B (Chlamydomonas) Gene [Source:MGI Symbol;Acc:MGI:1922386]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22072 Nonsense Available for shipment Available now
sa42005 Essential Splice Site Mutation detected in F1 DNA During 2018
sa16351 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22072
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073599 Nonsense 126 731 3 18

The following transcripts of ENSDARG00000051891 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 18688815)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17499392
GRCz11 12 17621266
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGGGTAGTTTTTCGCATGGGTTAATGCATGGCTATGGTGAATATATCTG[G/A]TCAGACGGTTTAAAGTATCAGGTATGTATGTAAAGTTTTAATAGAGGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42005
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073599 Essential Splice Site 191 731 4 18

The following transcripts of ENSDARG00000051891 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 18689182)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17499759
GRCz11 12 17621633
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTAACAGTGTACAGAGGTCAGTGGTACCTGGGGAAAAGACAAGGGCAGG[T/C]ATGTACTTACACATACACACATCCAATGTCTCAACTTTGCTTACACGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16351
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073599 Essential Splice Site 220 731 5 18

The following transcripts of ENSDARG00000051891 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 18689348)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17499925
GRCz11 12 17621799
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAGGGCGAATGGGTGAACAACTGCARAGAGGGATGGGGAAAACGGTGG[T/A]ATGTTTTCTGCAAWGTACATTTATTTACATCTCTTTCYAAAATTAATGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link