zgc:55671

Ensembl ID:
ENSDARG00000051888
ZFIN ID:
ZDB-GENE-030131-179
Description:
IST1 homolog [Source:RefSeq peptide;Acc:NP_997750]
Human Orthologue:
KIAA0174
Human Description:
KIAA0174 [Source:HGNC Symbol;Acc:28977]
Mouse Orthologue:
2400003C14Rik
Mouse Description:
RIKEN cDNA 2400003C14 gene Gene [Source:MGI Symbol;Acc:MGI:1919205]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21096 Essential Splice Site Available for shipment Available now
sa34202 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21096
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073596 Essential Splice Site None 354 None 10
ENSDART00000123273 Essential Splice Site None 342 None 9
ENSDART00000135259 Essential Splice Site None 341 None 10

The following transcripts of ENSDARG00000051888 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 57736745)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56172071
GRCz11 7 56473482
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTTTTTGTTTTATCTGATAAAGATATCAGGCTTTTGTTATTCATAAAC[A/T]GAGCTCCATCATGCTCGGTGGAGGGTTCAAATCCGAGAGACTTCGTGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34202
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073596 Essential Splice Site 147 354 None 10
ENSDART00000123273 Essential Splice Site 147 342 None 9
ENSDART00000135259 Essential Splice Site 147 341 None 10

The following transcripts of ENSDARG00000051888 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 57740690)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56176016
GRCz11 7 56477427
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATGGAAAGCTGTGTAGGACAAACCAGATTGGAACAGTTAATGATAGGG[T/A]ATGATGAAACGATTGTTTTGAGGTGGGGGAAATGACCCAATAGTGTTTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link