slc7a5

Ensembl ID:
ENSDARG00000051887
ZFIN ID:
ZDB-GENE-080818-4
Description:
large neutral amino acids transporter small subunit 1 [Source:RefSeq peptide;Acc:NP_001121830]
Human Orthologues:
SLC7A5, SLC7A5P2
Human Descriptions:
solute carrier family 7 (cationic amino acid transporter, y+ system), member 5 pseudogene 2 [Source:
solute carrier family 7 (cationic amino acid transporter, y+ system), member 5 [Source:HGNC Symbol;A
Mouse Orthologue:
Slc7a5
Mouse Description:
solute carrier family 7 (cationic amino acid transporter, y+ system), member 5 Gene [Source:MGI Symb

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13645 Essential Splice Site Available for shipment Available now
sa867 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13645
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073595 Essential Splice Site 396 523 7 10
Genomic Location (Zv9):
Chromosome 25 (position 13188220)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 12666239
GRCz11 25 12762744
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGATCCACCCTGACCTGCTGACTCCTCTGCCTTCACTCATATTTACTG[T/A]AGGTGTCCCAAAATCAAGCCCATAACTCTTAATATCATGTCCAGTTTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa867
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073595 Essential Splice Site 506 523 9 10
Genomic Location (Zv9):
Chromosome 25 (position 13198056)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 12656403
GRCz11 25 12752908
KASP Assay ID:
554-0769.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTYGGCGTTTGGTGGCAGACGAAGCCGAAATGGCTCCTGCAGATCATCTG[T/C]GAGTATTTTTAGNTTTTTGAATATTGTTAAATGCAATTGATGATGATCTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link