zgc:158222

Ensembl ID:
ENSDARG00000051873
ZFIN ID:
ZDB-GENE-070112-1522
Description:
adenosylhomocysteinase [Source:RefSeq peptide;Acc:NP_001074118]
Human Orthologues:
AHCYL1, AHCYL2
Human Descriptions:
adenosylhomocysteinase-like 1 [Source:HGNC Symbol;Acc:344]
adenosylhomocysteinase-like 2 [Source:HGNC Symbol;Acc:22204]
Mouse Orthologues:
Ahcyl1, Ahcyl2
Mouse Descriptions:
S-adenosylhomocysteine hydrolase-like 1 Gene [Source:MGI Symbol;Acc:MGI:2385184]
S-adenosylhomocysteine hydrolase-like 2 Gene [Source:MGI Symbol;Acc:MGI:1921590]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3295 Essential Splice Site F2 line generated During 2018
sa38074 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa3295
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073580 Essential Splice Site 286 516 8 17
Genomic Location (Zv9):
Chromosome 25 (position 22477843)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 21709719
GRCz11 25 21807267
KASP Assay ID:
554-2689.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACAGAAGTTTGACAACTTGTACTGCTGYAGGGAGTCCATTTTGGATAG[G/A]TAGGATGATACWAGTACTGTATGTRTCCCTAAGTTAATACTAATTTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38074
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073580 Nonsense 324 516 10 17
Genomic Location (Zv9):
Chromosome 25 (position 22477515)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 21709391
GRCz11 25 21806939
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGGAAAAGGCTGTTCTGCTGCTCTGAAAGCAATGGGATCTATTGTGTA[T/A]GTCACTGAAATTGACCCCATATGTGCTCTGCAAGCATGGTAAGGCAATAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Inflammatory biomarkers: A genome-wide association study of inflammatory biomarker changes in response to fenofibrate treatment in the Genetics of Lipid Lowering Drug and Diet Network. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link