ctu2

Ensembl ID:
ENSDARG00000051851
ZFIN ID:
ZDB-GENE-040801-79
Description:
Cytoplasmic tRNA 2-thiolation protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q6DC53]
Human Orthologue:
CTU2
Human Description:
cytosolic thiouridylase subunit 2 homolog (S. pombe) [Source:HGNC Symbol;Acc:28005]
Mouse Orthologue:
Ctu2
Mouse Description:
cytosolic thiouridylase subunit 2 homolog (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:1914215]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41034 Nonsense Mutation detected in F1 DNA During 2018
sa27063 Nonsense Mutation detected in F1 DNA During 2018
sa45299 Nonsense Mutation detected in F1 DNA During 2018
sa41035 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41034
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073555 Nonsense 128 501 6 15
ENSDART00000132852   None 163 None 6
ENSDART00000147539 Nonsense 128 234 7 8
Genomic Location (Zv9):
Chromosome 7 (position 56562634)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 54997960
GRCz11 7 55299371
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTTAGATGGTGGAGCTTGTGGGCGAAGTGAAGACGAGCGGCAGACTT[C/A]AATATCTCAGCTGAAAAACATCTTCACACAGACTGGCTTCCCCTACTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27063
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073555 Nonsense 214 501 7 15
ENSDART00000132852   None 163 None 6
ENSDART00000147539 Nonsense 214 234 8 8
Genomic Location (Zv9):
Chromosome 7 (position 56563679)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 54999005
GRCz11 7 55300416
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGCTCAATCTAGAAGATTCTGCATATTTACCTGAACACAAGCTGGCGT[T/G]ACAGAGATTGTTCTCATCACTCAAGACACTGTCAGCCAAACAGGAGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45299
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073555 Nonsense 215 501 7 15
ENSDART00000132852   None 163 None 6
ENSDART00000147539 Nonsense 215 234 8 8
Genomic Location (Zv9):
Chromosome 7 (position 56563681)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 54999007
GRCz11 7 55300418
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTCAATCTAGAAGATTCTGCATATTTACCTGAACACAAGCTGGCGTTA[C/T]AGAGATTGTTCTCATCACTCAAGACACTGTCAGCCAAACAGGAGATGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41035
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073555 Nonsense 231 501 7 15
ENSDART00000132852   None 163 None 6
ENSDART00000147539 Nonsense 231 234 8 8
Genomic Location (Zv9):
Chromosome 7 (position 56563730)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 54999056
GRCz11 7 55300467
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGAGATTGTTCTCATCACTCAAGACACTGTCAGCCAAACAGGAGATGT[T/A]ACAGACCCTGAGGTGAGTTTTTCAACCAACTCCTTTGCTTATCTTGTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link