si:dkeyp-19e1.3

Ensembl ID:
ENSDARG00000051836
ZFIN IDs:
ZDB-GENE-050506-81, ZDB-GENE-081104-56
Description:
Novel protein similar to vertebrate USP6 N-terminal like (USP6NL) [Source:UniProtKB/TrEMBL;Acc:B8A4E
Human Orthologues:
AC005702.1, AC053481.1, TBC1D26, TBC1D28, TBC1D3, TBC1D3B, TBC1D3C, TBC1D3F, TBC1D3G, TBC1D3H, USP6
Human Descriptions:
TBC1 domain family, member 26 [Source:HGNC Symbol;Acc:28745]
TBC1 domain family, member 28 [Source:HGNC Symbol;Acc:26858]
TBC1 domain family, member 3 [Source:HGNC Symbol;Acc:19031]
TBC1 domain family, member 3B [Source:HGNC Symbol;Acc:27011]
TBC1 domain family, member 3C [Source:HGNC Symbol;Acc:24889]
TBC1 domain family, member 3F [Source:HGNC Symbol;Acc:18257]
TBC1 domain family, member 3G [Source:HGNC Symbol;Acc:29860]
TBC1 domain family, member 3H [Source:HGNC Symbol;Acc:30708]
ubiquitin specific peptidase 6 (Tre-2 oncogene) [Source:HGNC Symbol;Acc:12629]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A6NN51]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16409 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16409
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067200   None 736 None 13
ENSDART00000134848 Essential Splice Site None 360 2 13
Genomic Location (Zv9):
Chromosome 25 (position 24862425)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 24041538
GRCz11 25 24139086
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCGGAAACTTGYTTTCATCCATTTGACAATTTGTTTTGTTCCTTTTCC[A/G]GATTTTGAGATGAAGAAGGACATCGACACGCTAATAGCAGAAGAACGGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Ovarian cancer: GWAS meta-analysis and replication identifies three new susceptibility loci for ovarian cancer. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link