zgc:63599

Ensembl ID:
ENSDARG00000051819
ZFIN ID:
ZDB-GENE-040426-1182
Description:
hypothetical protein LOC393645 [Source:RefSeq peptide;Acc:NP_956966]
Human Orthologue:
SWAP70
Human Description:
SWAP switching B-cell complex 70kDa subunit [Source:HGNC Symbol;Acc:17070]
Mouse Orthologue:
Swap70
Mouse Description:
SWA-70 protein Gene [Source:MGI Symbol;Acc:MGI:1298390]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8626 Nonsense Mutation detected in F1 DNA During 2018
sa21131 Nonsense Available for shipment Available now
sa21130 Nonsense Available for shipment Available now
sa45301 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa8626
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061302   None 224 None 6
ENSDART00000079899 Nonsense 416 587 9 12
Genomic Location (Zv9):
Chromosome 7 (position 69084157)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 66962178
GRCz11 7 67185826
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATGGAGGAGCAGGTGATTGAGAARTCGAATGAAGTGGAGCAGTACTGG[C/T]AGCGKATGCAGGAACTGGAGGAAATGTACCTTCAGCTCAAACAGGCTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21131
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061302   None 224 None 6
ENSDART00000079899 Nonsense 437 587 9 12
Genomic Location (Zv9):
Chromosome 7 (position 69084094)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 66962115
GRCz11 7 67185763
KASP Assay ID:
2259-9766.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGGAGGAAATGTACCTTCAGCTCAAACAGGCTCTGCAGGATGAGAAG[C/T]AGGCCAAGGAGGATGAAGAAATACTGCGCAAACTGCAGGCCAGGTAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21130
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061302   None 224 None 6
ENSDART00000079899 Nonsense 442 587 9 12
Genomic Location (Zv9):
Chromosome 7 (position 69084079)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 66962100
GRCz11 7 67185748
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTTCAGCTCAAACAGGCTCTGCAGGATGAGAAGCAGGCCAAGGAGGAT[G/T]AAGAAATACTGCGCAAACTGCAGGCCAGGTAACAGTACACAAACTCAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45301
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061302   None 224 None 6
ENSDART00000079899 Essential Splice Site 517 587 10 12
Genomic Location (Zv9):
Chromosome 7 (position 69083773)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 66961794
GRCz11 7 67185442
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGGAGAGCCTGAAAAGACAGAGGGAGGGAGCGGAGGAGGAATACATG[G/A]TAGCAGATTCACTTGGTCACACACACACACACACACACATACAGGGGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link