
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000051804
- Ensembl ID:
- ENSDARG00000051804
- Human Orthologues:
- CTD-2611O12.2, CTD-2611O12.3, ERMAP, RFPL1, RFPL2, RFPL3, RFPL4A, RFPL4B
- Human Descriptions:
- erythroblast membrane-associated protein (Scianna blood group) [Source:HGNC Symbol;Acc:15743]
- ret finger protein-like 1 [Source:HGNC Symbol;Acc:9977]
- ret finger protein-like 2 [Source:HGNC Symbol;Acc:9979]
- ret finger protein-like 3 [Source:HGNC Symbol;Acc:9980]
- ret finger protein-like 4A [Source:HGNC Symbol;Acc:16449]
- ret finger protein-like 4B [Source:HGNC Symbol;Acc:33264]
- Mouse Orthologues:
- Ermap, Rfpl4
- Mouse Descriptions:
- erythroblast membrane-associated protein Gene [Source:MGI Symbol;Acc:MGI:1349816]
- ret finger protein-like 4 Gene [Source:MGI Symbol;Acc:MGI:2149590]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa31623 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa31623
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098215 | Nonsense | 383 | 500 | 4 | 4 |
ENSDART00000130539 | Nonsense | 74 | 190 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 7 (position 76703752)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 73479647 GRCz11 7 73701760 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AATCAAGCATCACATCGGGAAGAGCGTTCTGGATGGTGGACGTCGGGAGG[A/T]AGGTGGGCTGGCAACTGGGCGTAATGAGAGAAGGGGCGAATATGAAAGGG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Carotid atherosclerosis in HIV infection: A genome-wide association study of carotid atherosclerosis in HIV-infected men. (View Study)
- Major depressive disorder: Common genetic variation and antidepressant efficacy in major depressive disorder: a meta-analysis of three genome-wide pharmacogenetic studies. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: