zgc:158610

Ensembl ID:
ENSDARG00000051798
ZFIN ID:
ZDB-GENE-070209-98
Description:
hypothetical protein LOC100009661 [Source:RefSeq peptide;Acc:NP_001076499]
Human Orthologue:
BRD1
Human Description:
bromodomain containing 1 [Source:HGNC Symbol;Acc:1102]
Mouse Orthologue:
Brd1
Mouse Description:
bromodomain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1924161]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24705 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24705
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073478 Essential Splice Site 449 1080 2 12
Genomic Location (Zv9):
Chromosome 25 (position 30685156)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 29252517
GRCz11 25 29695524
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGATACAGTGGTTCCAACGGTTTCTGGTCCTAGTATTACTCCTAAAAGG[T/C]AGGTGTGCATAACGGTTGCGTGATGTAATATCAGTGTTGCTGTACATGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link