zgc:112271

Ensembl ID:
ENSDARG00000051780
ZFIN ID:
ZDB-GENE-050522-443
Description:
Zgc:112271 protein [Source:UniProtKB/TrEMBL;Acc:Q502F6]
Human Orthologues:
BOLA2, BOLA2B
Human Descriptions:
bolA homolog 2 (E. coli) [Source:HGNC Symbol;Acc:29488]
bolA homolog 2B (E. coli) [Source:HGNC Symbol;Acc:32479]
Mouse Orthologue:
Bola2
Mouse Description:
bolA-like 2 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:1913412]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38648 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38648
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073459 Essential Splice Site 22 86 2 3
Genomic Location (Zv9):
Chromosome 7 (position 60038979)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 59258035
GRCz11 7 59563345
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAGTAATCTTGTGCCTTGTGTAAGAGTTACTTGCTTGCGTTTTTTTTC[A/G]GGATGTAGAAGACACGTCTCCAAGTAGATGTGCTGCAAGTTTTAAAGTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link