zgc:194989

Ensembl ID:
ENSDARG00000051778
ZFIN IDs:
ZDB-GENE-071004-32, ZDB-GENE-080723-3
Description:
histone 2, H2, like [Source:RefSeq peptide;Acc:NP_001122231]
Human Orthologues:
HIST1H2BA, HIST2H2BE
Human Descriptions:
histone cluster 1, H2ba [Source:HGNC Symbol;Acc:18730]
histone cluster 2, H2be [Source:HGNC Symbol;Acc:4760]
Mouse Orthologue:
Hist1h2ba
Mouse Description:
histone cluster 1, H2ba Gene [Source:MGI Symbol;Acc:MGI:2448375]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38137 Nonsense Mutation detected in F1 DNA During 2018
sa38136 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38137
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073457 Nonsense 44 124 1 1
Genomic Location (Zv9):
Chromosome 25 (position 36167365)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34601633
GRCz11 25 35106591
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGCAGAAGGACCAGGAAGGAGAGCTATGCTATCTACGTCTACAAAGTCT[T/A]GAAGCAGGTTCATCCCGACACTGGAATCTCTTCCAAGGCGATGGGCATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38136
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073457 Nonsense 46 124 1 1
Genomic Location (Zv9):
Chromosome 25 (position 36167360)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34601628
GRCz11 25 35106586
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGGACCAGGAAGGAGAGCTATGCTATCTACGTCTACAAAGTCTTGAAG[C/T]AGGTTCATCCCGACACTGGAATCTCTTCCAAGGCGATGGGCATCATGAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link