trim44

Ensembl ID:
ENSDARG00000051761
ZFIN ID:
ZDB-GENE-050522-37
Description:
tripartite motif-containing 44 [Source:RefSeq peptide;Acc:NP_001155221]
Human Orthologue:
TRIM44
Human Description:
tripartite motif-containing 44 [Source:HGNC Symbol;Acc:19016]
Mouse Orthologue:
Trim44
Mouse Description:
tripartite motif-containing 44 Gene [Source:MGI Symbol;Acc:MGI:1931835]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44366 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44366
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073439 Essential Splice Site 268 294 5 6
Genomic Location (Zv9):
Chromosome 25 (position 38253655)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 36764034
GRCz11 25 37334593
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAACTCCTGCTCTCCGCTCTGTGTTTCAGGATCCTGATGTGCGGCTCAG[G/A]TGAGTGTGTCCTGTGAAACTCTGCTGATGTGTGTGTGTGTTTGATGATGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link