zgc:173552

Ensembl ID:
ENSDARG00000051737
ZFIN ID:
ZDB-GENE-080220-24
Description:
histone cluster 3, H3 [Source:RefSeq peptide;Acc:NP_001104686]
Human Orthologue:
H3F3C
Human Description:
H3 histone, family 3C [Source:HGNC Symbol;Acc:33164]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13505 Nonsense Available for shipment Available now
sa17818 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13505
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073405 Nonsense 55 136 1 1
Genomic Location (Zv9):
Chromosome 25 (position 37366422)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35780068
GRCz11 25 36329787
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCACCGTTACAGGCCCGGTACCGTKGCTCTGCGTGAGATCCGTCGCTA[C/A]CAGAAGTCCACTGAGCTGCTGATCCGCAAACTGCCCTTYCAGCGTCTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17818
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073405 Nonsense 100 136 1 1
Genomic Location (Zv9):
Chromosome 25 (position 37366557)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35780203
GRCz11 25 36329922
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCTTCCAGAGCTCCGCCGTCATGGCTCTTCAGGAGTCCAGCGAAGCTTA[T/A]CTGGTCGGTCTGTTCGAGGACACYAACCTGTGCGCCATCCACGCCAAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link