apooa

Ensembl ID:
ENSDARG00000046154
ZFIN ID:
ZDB-GENE-031118-91
Description:
apolipoprotein O [Source:RefSeq peptide;Acc:NP_001032192]
Human Orthologue:
APOO
Human Description:
apolipoprotein O [Source:HGNC Symbol;Acc:28727]
Mouse Orthologues:
Apoo, Apoo-ps
Mouse Descriptions:
apolipoprotein O Gene [Source:MGI Symbol;Acc:MGI:1915566]
apolipoprotein O, pseudogene Pseudogene [Source:MGI Symbol;Acc:MGI:3649039]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30364 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30364
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067863 Essential Splice Site 192 205 7 9
ENSDART00000121857 Essential Splice Site 192 205 7 9
ENSDART00000127710 Essential Splice Site 203 216 8 10
Genomic Location (Zv9):
Chromosome Zv9_scaffold3516 (position 95386)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149681.1 95285
GRCz11 5 4387049
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGAAACTCTTTAAAGACAAACCTGCCTCAAAGAAAGACAAGCAAAAGG[T/C]GAACACATCTCTTACATCCTTACGTCTTTACATTTACAGAACATTACATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link