zgc:122989

Ensembl ID:
ENSDARG00000046124
ZFIN ID:
ZDB-GENE-051113-116
Description:
Zgc:122989 protein [Source:UniProtKB/TrEMBL;Acc:Q567J1]
Human Orthologue:
RAB11FIP1
Human Description:
RAB11 family interacting protein 1 (class I) [Source:HGNC Symbol;Acc:30265]
Mouse Orthologue:
Rab11fip1
Mouse Description:
RAB11 family interacting protein 1 (class I) Gene [Source:MGI Symbol;Acc:MGI:1923017]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34455 Nonsense Mutation detected in F1 DNA During 2018
sa44692 Nonsense Mutation detected in F1 DNA During 2018
sa27245 Nonsense Mutation detected in F1 DNA During 2018
sa41264 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34455
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067809 Nonsense 96 360 2 3
ENSDART00000124549 Nonsense 74 994 1 4
Genomic Location (Zv9):
Chromosome 8 (position 39113556)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 37968681
GRCz11 8 38001620
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACAGCGAAGGAGAAGGAGAGGGCAGTTCAGACTCTCCAAAGAAGAAAT[C/A]AAAGCTGAAATCCCTGTTTGGGCCAAAAACTAACCTCCAAAGGAATGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44692
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067809 Nonsense 128 360 2 3
ENSDART00000124549 Nonsense 106 994 1 4
Genomic Location (Zv9):
Chromosome 8 (position 39113460)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 37968585
GRCz11 8 38001524
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTCTCAGTCCATGTCAACCCTCGGCACCCTACCTGAGAAGAACAGTT[C/A]ACTTAGCAGCAGCAGATCATCAGGCCTTAATGTGGATTCTCCTGATGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27245
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067809 Nonsense 199 360 3 3
ENSDART00000124549 Nonsense 177 994 2 4
Genomic Location (Zv9):
Chromosome 8 (position 39110763)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 37965888
GRCz11 8 37998827
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAACCTCTGTATCAACGGCAGCCATGTTTATGCAGAGGATCAAGAACCC[A/T]AAGCCAGCTTTGGCTCCACGCTCAGCCTGAACAGCTCCGGAAAGGGTTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41264
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067809   None 360 None 3
ENSDART00000124549 Nonsense 673 994 3 4
Genomic Location (Zv9):
Chromosome 8 (position 39101076)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 37956201
GRCz11 8 37989140
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACATTTACCTCAGGATATGGAAAGGAAGACTCCTGATGGCATTACCTA[T/G]CAACCCTCCCATTCAATAGATAAGCCTACACCAGCCTCCAGGGTCAAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link