zgc:91999

Ensembl ID:
ENSDARG00000046122
ZFIN ID:
ZDB-GENE-040801-241
Description:
hypothetical protein LOC445104 [Source:RefSeq peptide;Acc:NP_001003498]
Human Orthologue:
PACSIN3
Human Description:
protein kinase C and casein kinase substrate in neurons 3 [Source:HGNC Symbol;Acc:8572]
Mouse Orthologue:
Pacsin3
Mouse Description:
protein kinase C and casein kinase substrate in neurons 3 Gene [Source:MGI Symbol;Acc:MGI:1891410]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24550 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24550
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067806 Essential Splice Site 150 304 3 7
Genomic Location (Zv9):
Chromosome 24 (position 39775888)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 38393494
GRCz11 24 38281375
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACGGCTTTCTCACGCGCTCAGAAGCCCTGGGTGAAAAGATTGAAGAAG[G/A]TGAGGGTGAAAATCGCTGGAGGGCGCAGACTGCTTCTGGTTAACAGCCGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link