
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:91999
- Ensembl ID:
- ENSDARG00000046122
- ZFIN ID:
- ZDB-GENE-040801-241
- Description:
- hypothetical protein LOC445104 [Source:RefSeq peptide;Acc:NP_001003498]
- Human Orthologue:
- PACSIN3
- Human Description:
- protein kinase C and casein kinase substrate in neurons 3 [Source:HGNC Symbol;Acc:8572]
- Mouse Orthologue:
- Pacsin3
- Mouse Description:
- protein kinase C and casein kinase substrate in neurons 3 Gene [Source:MGI Symbol;Acc:MGI:1891410]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa24550 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa24550
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000067806 | Essential Splice Site | 150 | 304 | 3 | 7 |
- Genomic Location (Zv9):
- Chromosome 24 (position 39775888)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 38393494 GRCz11 24 38281375 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGACGGCTTTCTCACGCGCTCAGAAGCCCTGGGTGAAAAGATTGAAGAAG[G/A]TGAGGGTGAAAATCGCTGGAGGGCGCAGACTGCTTCTGGTTAACAGCCGT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: