zgc:92757

Ensembl ID:
ENSDARG00000046106
ZFIN ID:
ZDB-GENE-040718-304
Description:
ras-related protein Rab-10 [Source:RefSeq peptide;Acc:NP_001002566]
Human Orthologue:
RAB10
Human Description:
RAB10, member RAS oncogene family [Source:HGNC Symbol;Acc:9759]
Mouse Orthologue:
Rab10
Mouse Description:
RAB10, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:105066]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37158 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37158
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067776 Nonsense 6 201 1 6
Genomic Location (Zv9):
Chromosome 20 (position 47763049)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 47576571
GRCz11 20 47435189
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTCTCTTCAGTGTGTGTTTATAAGAGCTCAGATGGCGAAGAAGACCTA[T/G]GATCTGCTCTTTAAACTGCTCTTGATTGGCGATTCTGGGGTGGGAAAGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link