si:dkey-38o19.9

Ensembl ID:
ENSDARG00000046079
ZFIN ID:
ZDB-GENE-100922-272
Human Orthologue:
CACNG6
Human Description:
calcium channel, voltage-dependent, gamma subunit 6 [Source:HGNC Symbol;Acc:13625]
Mouse Orthologue:
Cacng6
Mouse Description:
calcium channel, voltage-dependent, gamma subunit 6 Gene [Source:MGI Symbol;Acc:MGI:1859168]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42679 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42679
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067741 Nonsense 83 264 1 4
Genomic Location (Zv9):
Chromosome 16 (position 14588214)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12946673
GRCz11 16 12836793
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACGGAGTTCTGGGTGGAGCTTTCACAGCCAAAACACTTCAGGAACAAC[C/T]AGACATGTGAGATGGCGCATTATGGTCTGTGGAAATCTTGCGTTCGCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link