stk11

Ensembl ID:
ENSDARG00000046074
ZFIN ID:
ZDB-GENE-050417-383
Description:
serine/threonine-protein kinase 11 [Source:RefSeq peptide;Acc:NP_001017839]
Human Orthologue:
STK11
Human Description:
serine/threonine kinase 11 [Source:HGNC Symbol;Acc:11389]
Mouse Orthologue:
Stk11
Mouse Description:
serine/threonine kinase 11 Gene [Source:MGI Symbol;Acc:MGI:1341870]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11449 Essential Splice Site Available for shipment Available now
sa18484 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11449
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067736 Essential Splice Site 154 438 5 11
Genomic Location (Zv9):
Chromosome 2 (position 59883228)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 58953747
GRCz11 2 59051048
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTGTGTCTGTSTGTCTGYGTGTATGTATGTATGGYTGTGTCTCTCTCA[G/A]GTACTTCTGTCAGCTYCTGGATGGTCTGGAGTATTTGCACAGCCAGGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18484
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067736 Essential Splice Site 306 438 9 11
Genomic Location (Zv9):
Chromosome 2 (position 59888247)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 58958766
GRCz11 2 59056067
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCRCATACAACATTAAAACACRAATGATAGAGTAATGTGTGTGTTTTA[G/A]CTGGGTGCGCAAGAAACACGCSKCGTCGGAGCGTCCAGTGCCCATCCCRC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link