zgc:77838

Ensembl ID:
ENSDARG00000046071
ZFIN ID:
ZDB-GENE-040426-1889
Description:
hypothetical protein LOC402980 [Source:RefSeq peptide;Acc:NP_991243]
Human Orthologue:
C18orf25
Human Description:
chromosome 18 open reading frame 25 [Source:HGNC Symbol;Acc:28172]
Mouse Orthologue:
8030462N17Rik
Mouse Description:
RIKEN cDNA 8030462N17 gene Gene [Source:MGI Symbol;Acc:MGI:2444951]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14930 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14930
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067733 Nonsense 160 335 2 5
ENSDART00000139713 Nonsense 109 265 1 2
ENSDART00000140859 Nonsense 118 269 1 3

The following transcripts of ENSDARG00000046071 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 5295779)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4891923
GRCz11 21 5056488
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGCAATGGCGGCTAARAAGAACCGWTGCCAAGAGAAGCARGTGAAYGGA[C/T]GAGTGCGRGTTCGAGGGCCGCGCAGCCAGAGGCAGAAGCAGCGCATGCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link