vapal

Ensembl ID:
ENSDARG00000046048
ZFIN ID:
ZDB-GENE-040718-281
Description:
VAMP (vesicle-associated membrane protein)-associated protein A, like [Source:RefSeq peptide;Acc:NP
Human Orthologue:
VAPA
Human Description:
VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa [Source:HGNC Symbol;Acc:12648
Mouse Orthologues:
Mospd4, Vapa
Mouse Descriptions:
motile sperm domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:1919326]
vesicle-associated membrane protein, associated protein A Gene [Source:MGI Symbol;Acc:MGI:1353561]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15079 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15079
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098173 Nonsense 202 246 6 6
Genomic Location (Zv9):
Chromosome 2 (position 59296223)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 58498768
GRCz11 2 58427439
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATATTGTTATTGTTGTGTCCAGGATGARGGACTGCGGCTGCGGCGGCTC[C/T]AGCCACGCACTGATCATGTGTCCAGCAACAGCAGCACGTCTGTGGGCCGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link