zgc:65891

Ensembl ID:
ENSDARG00000046024
ZFIN ID:
ZDB-GENE-040426-1464
Description:
Partner of Y14 and mago [Source:UniProtKB/Swiss-Prot;Acc:Q6PH11]
Human Orthologue:
WIBG
Human Description:
within bgcn homolog (Drosophila) [Source:HGNC Symbol;Acc:30258]
Mouse Orthologue:
Wibg
Mouse Description:
within bgcn homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1925678]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21167 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21167
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067668 Nonsense 72 194 3 3
Genomic Location (Zv9):
Chromosome 8 (position 498322)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 388881
GRCz11 8 388881
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGAGCTGCCGCCGGGCGTGTGTGTGGAGACCCCCCCGCAGACACAGACG[C/T]AGCCGAGCGACGCCGCGGGCCTCTCCAGAACCGCCAAGCGCAACATGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link