
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:65891
- Ensembl ID:
- ENSDARG00000046024
- ZFIN ID:
- ZDB-GENE-040426-1464
- Description:
- Partner of Y14 and mago [Source:UniProtKB/Swiss-Prot;Acc:Q6PH11]
- Human Orthologue:
- WIBG
- Human Description:
- within bgcn homolog (Drosophila) [Source:HGNC Symbol;Acc:30258]
- Mouse Orthologue:
- Wibg
- Mouse Description:
- within bgcn homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1925678]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa21167 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa21167
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000067668 | Nonsense | 72 | 194 | 3 | 3 |
- Genomic Location (Zv9):
- Chromosome 8 (position 498322)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 388881 GRCz11 8 388881 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CGGAGCTGCCGCCGGGCGTGTGTGTGGAGACCCCCCCGCAGACACAGACG[C/T]AGCCGAGCGACGCCGCGGGCCTCTCCAGAACCGCCAAGCGCAACATGAAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: