snai1b

Ensembl ID:
ENSDARG00000046019
ZFIN IDs:
ZDB-GENE-980526-514, ZDB-GENE-980526-514
Description:
snail 1b [Source:RefSeq peptide;Acc:NP_571064]
Human Orthologue:
SNAI1
Human Description:
snail homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:11128]
Mouse Orthologue:
Snai1
Mouse Description:
snail homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:98330]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12547 Nonsense Available for shipment Available now
sa19312 Nonsense Mutation detected in F1 DNA During 2018
sa12537 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12547
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067652 Nonsense 225 256 3 3
ENSDART00000123322 Nonsense 224 255 5 5
ENSDART00000067652 Nonsense 225 256 3 3
ENSDART00000123322 Nonsense 224 255 5 5
ENSDART00000067652 Nonsense 225 256 3 3
ENSDART00000123322 Nonsense 224 255 5 5
Genomic Location (Zv9):
Chromosome 23 (position 2520433)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 2567301
GRCz11 23 2505501
KASP Assay ID:
554-6178.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCATTCGCTGACCGCTCGAACCTGCGGGCTCATCTGCAGACSCACKCC[G/T]AGGTGAAGAAGTACCAGTGCGGGTCKTGCTCTCGGAYCTTCAGCCGCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19312
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067652 Nonsense 225 256 3 3
ENSDART00000123322 Nonsense 224 255 5 5
ENSDART00000067652 Nonsense 225 256 3 3
ENSDART00000123322 Nonsense 224 255 5 5
ENSDART00000067652 Nonsense 225 256 3 3
ENSDART00000123322 Nonsense 224 255 5 5
Genomic Location (Zv9):
Chromosome 23 (position 2520433)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 2567301
GRCz11 23 2505501
KASP Assay ID:
554-6178.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCATTCGCTGACCGCTCGAACCTGCGGGCTCATCTGCAGACCCACTCC[G/T]AGGTGAAGAAGTACCAGTGCGGGTCGTGCTCTCGGACCTTCAGCCGCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12537
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067652 Nonsense 225 256 3 3
ENSDART00000123322 Nonsense 224 255 5 5
ENSDART00000067652 Nonsense 225 256 3 3
ENSDART00000123322 Nonsense 224 255 5 5
ENSDART00000067652 Nonsense 225 256 3 3
ENSDART00000123322 Nonsense 224 255 5 5
Genomic Location (Zv9):
Chromosome 23 (position 2520433)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 2567301
GRCz11 23 2505501
KASP Assay ID:
554-6178.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCATTCGCTGACCGCTCGAACCTGCGGGCTCATCTGCAGACSCACKCC[G/T]AGGTGAAGAAGTACCAGTGCGGGTCKTGCTCTCGGAYCTTCAGCCGCATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Psoriasis: Genome-wide association analysis identifies three psoriasis susceptibility loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link