zgc:110179

Ensembl ID:
ENSDARG00000046013
ZFIN ID:
ZDB-GENE-050417-384
Description:
Ras-like protein family member 11A-like [Source:UniProtKB/Swiss-Prot;Acc:A1DZY4]
Human Orthologue:
RASL11A
Human Description:
RAS-like, family 11, member A [Source:HGNC Symbol;Acc:23802]
Mouse Orthologue:
Rasl11a
Mouse Description:
RAS-like, family 11, member A Gene [Source:MGI Symbol;Acc:MGI:1916145]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41019 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41019
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067647 Nonsense 165 253 4 4
ENSDART00000098659   154 195 5 5

The following transcripts of ENSDARG00000046013 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 52771083)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 51040833
GRCz11 7 51315903
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAACATCCCTGTCATCATCGTGGGAAACAAGAGCGACCTTCTGCGAGCC[C/T]GACAGGTCTCAGATCCCGAAGGGAAGGCGCTGGCGGATGAATTGGGAGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link