zgc:103414

Ensembl ID:
ENSDARG00000045978
ZFIN ID:
ZDB-GENE-041114-95
Description:
hypothetical protein LOC492522 [Source:RefSeq peptide;Acc:NP_001007395]
Human Orthologue:
CHCHD6
Human Description:
coiled-coil-helix-coiled-coil-helix domain containing 6 [Source:HGNC Symbol;Acc:28184]
Mouse Orthologue:
Chchd6
Mouse Description:
coiled-coil-helix-coiled-coil-helix domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:1913348]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17527 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17527
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067586 Essential Splice Site 76 226 3 8
Genomic Location (Zv9):
Chromosome 6 (position 1616128)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 1560745
GRCz11 6 1513262
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCYTCCAGAGYATCTGCAGCAGAAACACAAGAGGAGCTGAAGAGACGG[T/G]CAGTGTCCAGCYGCACACGGTCATGTTCATCACTGTTTCTGAGGGCCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link