spg11

Ensembl ID:
ENSDARG00000045968
ZFIN ID:
ZDB-GENE-101017-1
Description:
spatacsin isoform 1 [Source:RefSeq peptide;Acc:NP_001181923]
Human Orthologue:
SPG11
Human Description:
spastic paraplegia 11 (autosomal recessive) [Source:HGNC Symbol;Acc:11226]
Mouse Orthologue:
Spg11
Mouse Description:
spastic paraplegia 11 Gene [Source:MGI Symbol;Acc:MGI:2444989]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30173 Nonsense Mutation detected in F1 DNA During 2018
sa32507 Nonsense Available for shipment Available now
sa44211 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30173
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067558 Nonsense 627 1365 13 25
Genomic Location (Zv9):
Chromosome 25 (position 1150776)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 1018817
GRCz11 25 1103360
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGAGGAGTGTGTGAGGATCATGGAGGAGCTGCAGGACGCCGGACTCTA[C/A]ATGCAGGCGCGCAGAGTCGCAGAGCTGGCCGAGCTGCCCGCACACACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32507
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067558 Nonsense 917 1365 16 25
Genomic Location (Zv9):
Chromosome 25 (position 1146640)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 1014681
GRCz11 25 1099228
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTCCAGCTGCTGGTGGATCAGTGCAGCCACGGCAAGAGTTACTGCAAA[C/T]AAGTGCTGAGCCTCTACCAGCTCTCCAAGGTCAACACTGCTTTACTTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44211
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067558 Essential Splice Site 926 1365 16 25
Genomic Location (Zv9):
Chromosome 25 (position 1146610)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 1014651
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGCAAGAGTTACTGCAAACAAGTGCTGAGCCTCTACCAGCTCTCCAAG[G/A]TCAACACTGCTTTACTTCCTGCTGCTCGCTTACAATGCTGTCAAGGCATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link