zgc:136569

Ensembl ID:
ENSDARG00000045944
ZFIN ID:
ZDB-GENE-060519-23
Description:
hypothetical protein LOC692318 [Source:RefSeq peptide;Acc:NP_001038752]
Human Orthologue:
SLC6A1
Human Description:
solute carrier family 6 (neurotransmitter transporter, GABA), member 1 [Source:HGNC Symbol;Acc:11042
Mouse Orthologue:
Slc6a1
Mouse Description:
solute carrier family 6 (neurotransmitter transporter, GABA), member 1 Gene [Source:MGI Symbol;Acc:M

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37607 Nonsense Mutation detected in F1 DNA During 2018
sa24248 Nonsense Available for shipment Available now
sa37606 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37607
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067530   None 431 3 15
ENSDART00000124613 Nonsense 116 679 2 14
ENSDART00000133701 Nonsense 116 679 3 15
Genomic Location (Zv9):
Chromosome 23 (position 4909784)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 4918483
GRCz11 23 4854068
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAATGCGCTCTTGGACAATACACATCCATTGGTGGCCTCGGGGTTTGG[A/T]AACTAGCGCCAATGTTTAAAGGTATATGGTTCATATCAACACATTCTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24248
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067530 Nonsense 119 431 10 15
ENSDART00000124613 Nonsense 367 679 9 14
ENSDART00000133701 Nonsense 367 679 10 15
Genomic Location (Zv9):
Chromosome 23 (position 4905778)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 4914477
GRCz11 23 4850062
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGCTTTTTTTATGGCTTACACAGGACCGGGTTTGGCATTTTTAGCTTA[T/A]CCGGAAGCTGTAACGCAGTTGCCCGTTTCACCACTGTGGGCCATTCTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37606
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067530 Essential Splice Site 149 431 11 15
ENSDART00000124613 Essential Splice Site 397 679 10 14
ENSDART00000133701 Essential Splice Site 397 679 11 15
Genomic Location (Zv9):
Chromosome 23 (position 4900077)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 4908776
GRCz11 23 4844361
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTGCATATAAATACAGCACAGCTACAGCATTGTTGACGTTGGTTTGCA[G/A]TTCTGTACAGTGGAGGGCTTCATCACTGCTCTGGTGGATGAGTTCCCACG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link