
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
immp1l
- Ensembl ID:
- ENSDARG00000045935
- ZFIN ID:
- ZDB-GENE-070522-4
- Human Orthologue:
- IMMP1L
- Human Description:
- IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae) [Source:HGNC Symbol;Acc:26317]
- Mouse Orthologue:
- Immp1l
- Mouse Description:
- IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:191
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa20884 | Nonsense | Available for shipment | Available now |
sa844 | Splice Site, Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa20884
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114062 | Nonsense | 54 | 189 | 2 | 6 |
- Genomic Location (Zv9):
- Chromosome 7 (position 16816822)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 15799520 GRCz11 7 16051493 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTTGGCTACACCGTCCAGTATGGCTGCATCGCTCACTGCGCCTTTGAATA[T/A]GTTGGTGAATTTGTATCGGTAGGTTTTTTTTTTTTGTCGTTGTGGGGGGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa844
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Splice Site, Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114062 | Splice Site, Nonsense | 132 | 189 | 4 | 6 |
- Genomic Location (Zv9):
- Chromosome 7 (position 16817243)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 15799941 GRCz11 7 16051914 - KASP Assay ID:
- 554-0747.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GACAAGGTCTGCWCCAGCGGACCATCTGACATCTTTAAAACACACACTTA[T/A]GTAAGTACCACCACACCTGACATAATACAAAAACTTTATATAATATACTG
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: