
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
Q5U400_DANRE
- Ensembl ID:
- ENSDARG00000045921
- Description:
- Zc3hdc1l protein [Source:UniProtKB/TrEMBL;Acc:Q5U400]
- Human Orthologue:
- ZC3HAV1
- Human Description:
- zinc finger CCCH-type, antiviral 1 [Source:HGNC Symbol;Acc:23721]
- Mouse Orthologue:
- Zc3hav1
- Mouse Description:
- zinc finger CCCH type, antiviral 1 Gene [Source:MGI Symbol;Acc:MGI:1926031]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa43346 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa23600 | Essential Splice Site | Available for shipment | Available now |
sa8545 | Splice Site, Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa43346
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000067497 | Essential Splice Site | 419 | 782 | 7 | 12 |
- Genomic Location (Zv9):
- Chromosome 19 (position 46832144)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 22922 GRCz11 4 274775 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CACAGGCCTGGTGTTCAGGACTAATATATAGTGAATCTGTCCTTCTCCTC[A/T]GACATGATCCAAACAAACAAGCAGTACAAAACCAAAAAAGTGATCAGACG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23600
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000067497 | Essential Splice Site | 477 | 782 | 9 | 12 |
- Genomic Location (Zv9):
- Chromosome 19 (position 46832733)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 23511 GRCz11 4 274186 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TATATATATAGTGATGAGTTTGGTATATAACTCTATATGTGTGTTGACGC[A/G]GAGAGTGCAGCTGACAAAAACCACAGCCGAATTCATCAAAATACAGGAGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa8545
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Splice Site, Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000067497 | Splice Site, Nonsense | 520 | 782 | 9 | 12 |
- Genomic Location (Zv9):
- Chromosome 19 (position 46832865)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 23643 GRCz11 4 274054 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCAGAWKATCGAGAGGATCCAGAACAAAGCATTGTGGGAGGTGTTCCAGT[G/A]GTGAGTCCATCACAGCACTGACTTRTATWACATCCTGAAAGNTRTGTGCA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: