zgc:101791

Ensembl ID:
ENSDARG00000045889
ZFIN ID:
ZDB-GENE-041212-48
Description:
transmembrane protease serine 2 [Source:RefSeq peptide;Acc:NP_001008623]
Human Orthologue:
TMPRSS2
Human Description:
transmembrane protease, serine 2 [Source:HGNC Symbol;Acc:11876]
Mouse Orthologue:
Tmprss2
Mouse Description:
transmembrane protease, serine 2 Gene [Source:MGI Symbol;Acc:MGI:1354381]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21790 Nonsense Available for shipment Available now
sa34966 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa21790
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126157 Nonsense 318 486 10 14
Genomic Location (Zv9):
Chromosome 10 (position 39999258)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 38780733
GRCz11 10 38724140
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGGGCTGGACGGTGTATGCTGGATATCTGACCCAATCAGAGATGGCGT[C/A]GGCCTCCGGAAACTCTGTAAACCGAATTGTCATTCATGATTTCAACCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34966
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126157 Essential Splice Site 433 486 12 14
Genomic Location (Zv9):
Chromosome 10 (position 39996253)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 38783738
GRCz11 10 38727145
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACCATGATCTGTGCTGGAAAGCTGGCAGGCGGCGTGGACTCCTGTCAG[G/A]TCAGAAACGCAAACAATAGCTGCCCCATCAGATCTGTAAAGCTGATTATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link