srsf2ip

Ensembl ID:
ENSDARG00000045885
ZFIN ID:
ZDB-GENE-041210-22
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q5SPB2]
Human Orthologue:
SRSF2IP
Human Description:
serine/arginine-rich splicing factor 2, interacting protein [Source:HGNC Symbol;Acc:10784]
Mouse Orthologue:
Srsf2ip
Mouse Description:
serine/arginine-rich splicing factor 2, interacting protein Gene [Source:MGI Symbol;Acc:MGI:1919443]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17137 Nonsense Available for shipment Available now
sa18449 Nonsense Available for shipment Available now
sa20173 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17137
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067444 Nonsense 644 965 4 8
Genomic Location (Zv9):
Chromosome 4 (position 1492186)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 1783818
GRCz11 4 1633131
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCAGGGACCRCTAATAATGCAGATTCATACAATCGCTTTAATGATAGC[A/T]GAGCTGGAGGGAAGAGGAAAGAGTCTGAAGGTGCAGAGGCTCCACTGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18449
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067444 Nonsense 684 965 4 8
Genomic Location (Zv9):
Chromosome 4 (position 1492308)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 1783940
GRCz11 4 1633253
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGAGTTGGGCAGTGCGGCGAACTCTTCCMGCTGATGTGCAGAACTACTA[C/A]TCRCGCAGAGAWCGAGGTGGTGGCGGCGGTGGAAACAACATCTGGAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20173
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067444 Nonsense 937 965 8 8
Genomic Location (Zv9):
Chromosome 4 (position 1498749)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 1790381
GRCz11 4 1639694
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGACGGTGTTGTTTTCCTCCTCTCAGGTGTGTCACAGCAAGAGTGGC[G/T]AGGTGAACGCAGACAAGGTGGCCACTCTGGTGAAGGCGTATGTGGACAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link