si:dkey-61f9.2

Ensembl ID:
ENSDARG00000045867
ZFIN ID:
ZDB-GENE-041210-12
Description:
Novel protein containing Lectin C-type domain [Source:UniProtKB/TrEMBL;Acc:Q5RIZ7]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20186 Essential Splice Site Available for shipment Available now
sa40207 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa20186
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067413 Essential Splice Site 134 365 3 5
ENSDART00000136225 Essential Splice Site 132 242 2 3
Genomic Location (Zv9):
Chromosome 4 (position 3676411)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 3795024
GRCz11 4 3803937
KASP Assay ID:
554-6372.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAATCTGTCTTATGCAATGAGACAAAACACTTCATGTGCTATGAACAAG[G/A]TAATAAATACCAGTTTATAAATATTAAATGTAATTAAATGAAACAAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40207
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067413 Nonsense 204 365 4 5
ENSDART00000136225 Nonsense 202 242 3 3
Genomic Location (Zv9):
Chromosome 4 (position 3676135)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 3794748
GRCz11 4 3803661
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCTTTCTGGATCGGCCTGCTGAATGACAGTGTGGACTGGAGAGATGGA[G/T]GACGATCTGCTTACAGAAACTGGCGTGAGAAGACTAATCACAGCATGAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link