si:dkey-3n7.4

Ensembl ID:
ENSDARG00000045864
ZFIN ID:
ZDB-GENE-041210-356
Description:
Novel protein similar to vertebrate tropomodulin 1 (TMOD1) [Source:UniProtKB/TrEMBL;Acc:Q5RGR5]
Human Orthologue:
LMOD2
Human Description:
leiomodin 2 (cardiac) [Source:HGNC Symbol;Acc:6648]
Mouse Orthologue:
Lmod2
Mouse Description:
leiomodin 2 (cardiac) Gene [Source:MGI Symbol;Acc:MGI:2135672]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20187 Nonsense Available for shipment Available now
sa38418 Essential Splice Site, Missense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa20187
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067409 Nonsense 47 596 1 3
ENSDART00000138221 Nonsense 57 604 1 2
Genomic Location (Zv9):
Chromosome 4 (position 3991732)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 4110345
GRCz11 4 4119258
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAAGAGGCCATGAGTACATTCGGCTACCGTCGGGAACTCAGTAAGTAC[G/T]AGGATTTGGATGAAGATGAGCTGTTGGCTTCACTCACAGCCGAGGAGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38418
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067409 Essential Splice Site 588 596 2 3
ENSDART00000138221 Missense 599 604 2 2
Genomic Location (Zv9):
Chromosome 4 (position 3989494)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 4108107
GRCz11 4 4117020
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAACTCATGGCCGCCATCAGAGGCAGCAGCGTCAGAAATCTCAGAAGG[G/A]TGAGTATCACAAAATCTGTCAGGCTCTGTTCTGAAACAGTCAACTTTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link