si:dkey-3n7.3

Ensembl ID:
ENSDARG00000045863
ZFIN ID:
ZDB-GENE-041210-265
Description:
ankyrin repeat and SOCS box-containing [Source:RefSeq peptide;Acc:NP_001034979]
Human Orthologue:
ASB15
Human Description:
ankyrin repeat and SOCS box-containing 15 [Source:HGNC Symbol;Acc:19767]
Mouse Orthologue:
Asb15
Mouse Description:
ankyrin repeat and SOCS box-containing 15 Gene [Source:MGI Symbol;Acc:MGI:1926160]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20189 Nonsense Available for shipment Available now
sa20188 Essential Splice Site Available for shipment Available now
sa33365 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa20189
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067407 Nonsense 75 586 3 10
ENSDART00000146889 Nonsense 75 584 3 9
Genomic Location (Zv9):
Chromosome 4 (position 3999672)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 4118285
GRCz11 4 4127198
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTAAGGAAAATGCACAAATGCAGTGAAGCCTATAAGGAAAGAGACAGC[A/T]GAGGTTTGCTGCCGATGCACAGAGCGTGTGTTCAGCCTGATTCCTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20188
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067407 Essential Splice Site 292 586 7 10
ENSDART00000146889 Essential Splice Site 290 584 7 9
ENSDART00000067407 Essential Splice Site 292 586 7 10
ENSDART00000146889 Essential Splice Site 290 584 7 9
Genomic Location (Zv9):
Chromosome 4 (position 3995416)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 4114029
GRCz11 4 4122942
KASP Assay ID:
2259-4391.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACACTTCCCAACCATATTACAAATCTTTGTGTCTCTTTTTAAACCTCC[A/G]GAGCTCTGAAGACATTAATTCCCATCACCACAAAAAGGGCCATCCGGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33365
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067407 Essential Splice Site 292 586 7 10
ENSDART00000146889 Essential Splice Site 290 584 7 9
ENSDART00000067407 Essential Splice Site 292 586 7 10
ENSDART00000146889 Essential Splice Site 290 584 7 9
Genomic Location (Zv9):
Chromosome 4 (position 3995416)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 4114029
GRCz11 4 4122942
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACACTTCCCAACCATATTACAAATCTTTGTGTCTCTTTTTAAACCTCC[A/G]GAGCTCTGAAGACATTAATTCCCATCACCACAAAAAGGGCCATCCGGCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link