zgc:113263

Ensembl ID:
ENSDARG00000045842
ZFIN ID:
ZDB-GENE-050306-34
Description:
hypothetical protein LOC503753 [Source:RefSeq peptide;Acc:NP_001013349]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6046 Essential Splice Site Mutation detected in F1 DNA During 2018
sa30606 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6046
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067371   None 430 None 8
ENSDART00000123375 Essential Splice Site 937 1111 16 20
Genomic Location (Zv9):
Chromosome 4 (position 5232176)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5350357
GRCz11 4 5358927
KASP Assay ID:
554-3883.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTGCCACTCGCGTATCAAAAGACTCAAGTCCCAGTTCTACTACGATGG[G/A]TGAGCGAGATGTGACTAGTATTGTRTAMTCTAATTGCATGCATATACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30606
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067371   None 430 None 8
ENSDART00000123375 Essential Splice Site 974 1111 18 20
Genomic Location (Zv9):
Chromosome 4 (position 5234142)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5352323
GRCz11 4 5360893
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTACATTTCCCATCTCATTTACTCTTTTGAAATGTATTTGCATTTTCA[G/A]ACTCCCTCGCTCTCTCCAAACCTCTCACCACGGACGGGCCGAAGCTGGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link