
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-14d8.21
- Ensembl ID:
- ENSDARG00000045837
- ZFIN ID:
- ZDB-GENE-041210-147
- Description:
- Novel protein similar to vertebrate protein deleted in malignant brain tumors 1 [Source:UniProtKB/Tr
- Human Orthologues:
- AC008735.1, CD5L
- Human Descriptions:
- CD5 molecule-like [Source:HGNC Symbol;Acc:1690]
- Scavenger receptor cysteine-rich domain-containing protein LOC284297 [Source:UniProtKB/Swiss-Prot;Ac
- Mouse Orthologues:
- A430110N23Rik, Cd5l
- Mouse Descriptions:
- CD5 antigen-like Gene [Source:MGI Symbol;Acc:MGI:1334419]
- RIKEN cDNA A430110N23 gene Gene [Source:MGI Symbol;Acc:MGI:3606211]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa26211 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa40215 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa26211
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000041166 | Nonsense | 357 | 665 | 4 | 8 |
ENSDART00000136960 | Nonsense | 381 | 940 | 4 | 9 |
The following transcripts of ENSDARG00000045837 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 4 (position 5346880)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 5465061 GRCz11 4 5473631 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTCGAGAGCTTGGCTGTGGTCCTTTCAATAAGACATACAGTAGAGCTTA[T/A]CTTGGCCCCGGTTCCGGTAACATACTAATGGATAATCTACAGTGCAATGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40215
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000041166 | Nonsense | 394 | 665 | 4 | 8 |
ENSDART00000136960 | Nonsense | 418 | 940 | 4 | 9 |
The following transcripts of ENSDARG00000045837 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 4 (position 5346990)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 5465171 GRCz11 4 5473741 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTCGCTGAATCAATGCAGCTTCTCTGCCTCTATAAGCTCCTGTACACATT[C/A]ACAAGATGCCGGAGTTGTCTGTGGAGGTAAATATAAACAAAGAGAGTTCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: