zgc:86905

Ensembl ID:
ENSDARG00000045836
ZFIN ID:
ZDB-GENE-040625-75
Description:
mitogen-activated protein kinase 11 [Source:RefSeq peptide;Acc:NP_001002095]
Human Orthologue:
MAPK11
Human Description:
mitogen-activated protein kinase 11 [Source:HGNC Symbol;Acc:6873]
Mouse Orthologue:
Mapk11
Mouse Description:
mitogen-activated protein kinase 11 Gene [Source:MGI Symbol;Acc:MGI:1338024]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40216 Essential Splice Site Mutation detected in F1 DNA During 2018
sa38421 Nonsense Mutation detected in F1 DNA During 2018
sa20195 Nonsense Available for shipment Available now
sa26212 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40216
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032857 Essential Splice Site 81 361 2 12

The following transcripts of ENSDARG00000045836 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 5386437)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5504618
GRCz11 4 5513188
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGAACATACAGAGAACTGAGACTACTCAAACACATGAAGCACGAGAAT[G/A]TTAGTCCCTCAAGACACCCATAAACATGTAATTACATGAACACAGGGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38421
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032857 Nonsense 181 361 7 12

The following transcripts of ENSDARG00000045836 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 5390653)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5508834
GRCz11 4 5517404
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCTCGATTTTGGGTTGGCCAGACAAACAGATGATGAGATGACGGGCTA[T/A]GTGGCGACTCGTTGGTACAGAGCACCAGAGATCATGCTTAACTGGATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20195
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032857 Nonsense 206 361 8 12

The following transcripts of ENSDARG00000045836 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 5390824)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5509005
GRCz11 4 5517575
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAAGCAATTAGTTAATTAAATAAGTTTGTGCTTTACAGTGGATATCTG[G/A]TCTGTCGGATGCATCATGGGTGAGCTTCTGAAGGGGAAGGTTTTGTTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26212
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032857 Essential Splice Site 254 361 None 12

The following transcripts of ENSDARG00000045836 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 5391923)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5510104
GRCz11 4 5518674
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCAATGCAGAACTTAATATTTGATTTGGGTTTTTTGTGCTGTGCATCT[A/G]GGCTCAGAAGTACATCCAGTCTCTTCCGCACATGCCGCAGCAGGACCTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link