wu:fi26e04

Ensembl ID:
ENSDARG00000045828
ZFIN ID:
ZDB-GENE-030131-5941
Human Orthologues:
ZYG11A, ZYG11B
Human Descriptions:
zyg-11 homolog A (C. elegans) [Source:HGNC Symbol;Acc:32058]
zyg-11 homolog B (C. elegans) [Source:HGNC Symbol;Acc:25820]
Mouse Orthologues:
Zyg11a, Zyg11b
Mouse Descriptions:
zyg-11 homolog A (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2446208]
zyg-ll homolog B (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2685277]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38308 Essential Splice Site Mutation detected in F1 DNA During 2018
sa13583 Essential Splice Site Available for shipment Available now
sa13217 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38308
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067356 Essential Splice Site 370 735 3 14
Genomic Location (Zv9):
Chromosome 2 (position 3521655)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 3101024
GRCz11 2 2942913
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTACAGTCACACCAGTGAATTAGAAGAACCTCAGCCAAACATTTTAAAG[G/T]TATTTACCAGTTTATTTAACAGTTTGTTTTATTATTATTATCTGTGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13583
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067356 Essential Splice Site 502 735 8 14
Genomic Location (Zv9):
Chromosome 2 (position 3516224)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 3095593
GRCz11 2 2937482
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATCTGTGAATTGTTGTCAAATGWAAATGATTGKTATTGTGTGTRAATGC[A/T]GCAGCTGCTGAGTATCGTCCAGCAGAAAGCGTCTCTGGGTCTGGTGGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13217
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067356 Nonsense 611 735 10 14
Genomic Location (Zv9):
Chromosome 2 (position 3512965)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 3092334
GRCz11 2 2934223
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WCCAGCTGCTGGTCCTGCCGCTGGTRGAGGTGGAYGTCAGCTACTTTGCT[G/T]GAGGGATTTTGRCTCATCTGGTGTCCGTCAGRGGGCCCGTGTGGAGTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link