zgc:101783

Ensembl ID:
ENSDARG00000045824
ZFIN ID:
ZDB-GENE-040912-48
Description:
hypothetical protein LOC447883 [Source:RefSeq peptide;Acc:NP_001004622]
Human Orthologue:
FAM3C
Human Description:
family with sequence similarity 3, member C [Source:HGNC Symbol;Acc:18664]
Mouse Orthologue:
Fam3c
Mouse Description:
family with sequence similarity 3, member C Gene [Source:MGI Symbol;Acc:MGI:107892]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10699 Essential Splice Site Available for shipment Available now
sa44286 Splice Site, Nonsense Mutation detected in F1 DNA During 2018
sa38061 Nonsense Mutation detected in F1 DNA During 2018
sa44287 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa10699
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067354 Essential Splice Site 42 241 3 9
ENSDART00000138851 Essential Splice Site 42 192 4 9
ENSDART00000138946 Essential Splice Site 42 79 4 5
ENSDART00000145334 Essential Splice Site 55 183 5 9

The following transcripts of ENSDARG00000045824 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 20226811)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19638788
GRCz11 25 19736739
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TYCTACTGATGCATGCRATGTATGGTATATATATATTTGTGTAAAACACA[G/C]AAAGGTCAGTGGATGAAATGCATTTAGTCCCGTCGAAACCTGATGTTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44286
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067354 Splice Site, Nonsense 107 241 5 9
ENSDART00000138851 Splice Site, Nonsense 107 192 6 9
ENSDART00000138946   None 79 None 5
ENSDART00000145334 Splice Site, Nonsense 120 183 7 9

The following transcripts of ENSDARG00000045824 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 20227325)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19639302
GRCz11 25 19737253
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTAAATCACAAGTGGAGTTTAAGCCAGTTCTGCAATTTTGTTTAAGGT[T/A]AATACAGAAAGAGACACGAGGTAACTGGCTTGGAATTAATATTGCTGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38061
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067354 Nonsense 140 241 6 9
ENSDART00000138851 Nonsense 140 192 7 9
ENSDART00000138946   None 79 None 5
ENSDART00000145334 Nonsense 153 183 8 9

The following transcripts of ENSDARG00000045824 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 20228707)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19640684
GRCz11 25 19738635
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTCAGAAGAAACGGGTGAGCACGTCAAAACTGGCAGCTTCAATATGTG[G/A]ACTGGAAGTATGTTTCATCTTCATGTTACTGATCTAATTTCTTACCTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44287
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067354 Nonsense 142 241 6 9
ENSDART00000138851 Nonsense 142 192 7 9
ENSDART00000138946   None 79 None 5
ENSDART00000145334 Nonsense 155 183 8 9

The following transcripts of ENSDARG00000045824 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 20228711)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19640688
GRCz11 25 19738639
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAAGAAACGGGTGAGCACGTCAAAACTGGCAGCTTCAATATGTGGACT[G/T]GAAGTATGTTTCATCTTCATGTTACTGATCTAATTTCTTACCTTGTAAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: A large-scale genome-wide association study of Asian populations uncovers genetic factors influencing eight quantitative traits. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link