
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
samm50
- Ensembl ID:
- ENSDARG00000045814
- ZFIN ID:
- ZDB-GENE-040426-806
- Description:
- Sorting and assembly machinery component 50 homolog A [Source:UniProtKB/Swiss-Prot;Acc:Q803G5]
- Human Orthologue:
- SAMM50
- Human Description:
- sorting and assembly machinery component 50 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:24276]
- Mouse Orthologue:
- Samm50
- Mouse Description:
- sorting and assembly machinery component 50 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa11533 | Essential Splice Site | Available for shipment | Available now |
sa24653 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa11533
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000104420 | Essential Splice Site | 143 | 469 | 5 | 15 |
- Genomic Location (Zv9):
- Chromosome 25 (position 19503763)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 18915740 GRCz11 25 19013691 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AATGACAGGAAGTTACAACACCATGGTTGGGAACAAYGAGGGCAGCATGG[T/C]GAGATCCTGAAGACGYCTGTGTGTGTTTGTKATGAWGAGGAATCACARAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24653
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000104420 | Nonsense | 465 | 469 | 15 | 15 |
- Genomic Location (Zv9):
- Chromosome 25 (position 19511609)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 18923586 GRCz11 25 19021537 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTTTTGTTTTTTCTGTCTCAGGATATGTGACGGAGTGCAGTTTGGGGCC[G/T]GAATCCGCTTCCTGTGATTTTTCGACTATCGTGTCACTTTCTAACCTGTG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Liver enzyme levels: Population-based genome-wide association studies reveal six loci influencing plasma levels of liver enzymes. (View Study)
- Liver enzyme levels (gamma-glutamyl transferase): Genome-wide association study identifies loci influencing concentrations of liver enzymes in plasma. (View Study)
- Non-alcoholic fatty liver disease: Genome-wide scan revealed that polymorphisms in the PNPLA3, SAMM50, and PARVB genes are associated with development and progression of nonalcoholic fatty liver disease in Japan. (View Study)
- Nonalcoholic fatty liver disease: Genetic polymorphisms of the human PNPLA3 gene are strongly associated with severity of non-alcoholic fatty liver disease in Japanese. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: