
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
mfge8b
- Ensembl ID:
- ENSDARG00000045803
- ZFIN ID:
- ZDB-GENE-070209-137
- Description:
- milk fat globule-EGF factor 8 protein b [Source:RefSeq peptide;Acc:NP_001074459]
- Human Orthologues:
- F8, MFGE8
- Human Descriptions:
- coagulation factor VIII, procoagulant component [Source:HGNC Symbol;Acc:3546]
- milk fat globule-EGF factor 8 protein [Source:HGNC Symbol;Acc:7036]
- Mouse Orthologue:
- Mfge8
- Mouse Description:
- milk fat globule-EGF factor 8 protein Gene [Source:MGI Symbol;Acc:MGI:102768]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa38056 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa44279 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa38056
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000067324 | Nonsense | 372 | 473 | 8 | 10 |
- Genomic Location (Zv9):
- Chromosome 25 (position 19671560)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 19083537 GRCz11 25 19181488 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACAGGGCAAGACCAACGCCTGGACGGCAGCTACAAACAACCGCTCCGAGT[G/A]GCTGCAGGTGAGACACGAAAAACTTTTAGGGTTGTAAAAAGAGATGGAGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44279
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000067324 | Essential Splice Site | 426 | 473 | 9 | 10 |
- Genomic Location (Zv9):
- Chromosome 25 (position 19674254)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 19086231 GRCz11 25 19184182 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CGGCCAACACTGGACGATACTCAAAGAAGACAAGACCAAAACAGATAAGG[T/C]TGGGTTCTAAACACAATTTAATTCATTATGTGAAATCAGCGTGAAATTAC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Antineutrophil cytoplasmic antibody-associated vasculitis : Genetically distinct subsets within ANCA-associated vasculitis. (View Study)
- Red blood cell traits: Genome-wide association analysis of red blood cell traits in African Americans: the COGENT Network. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: