srgap2b

Ensembl ID:
ENSDARG00000045789
ZFIN ID:
ZDB-GENE-041210-103
Description:
SLIT-ROBO Rho GTPase-activating protein 1 [Source:RefSeq peptide;Acc:NP_001025266]
Human Orthologue:
SRGAP1
Human Description:
SLIT-ROBO Rho GTPase activating protein 1 [Source:HGNC Symbol;Acc:17382]
Mouse Orthologue:
Srgap1
Mouse Description:
SLIT-ROBO Rho GTPase activating protein 1 Gene [Source:MGI Symbol;Acc:MGI:2152936]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20208 Nonsense Available for shipment Available now
sa44583 Nonsense Mutation detected in F1 DNA During 2018
sa14806 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20208
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014897 Nonsense 100 1035 3 20
ENSDART00000048707 Nonsense 100 1071 3 22
Genomic Location (Zv9):
Chromosome 4 (position 8373806)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9301314
GRCz11 4 9302230
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGTGTTCCTAAGGAAGGACCAGAATCTGCTGTCTCCAGTGAACTGCTG[G/A]TATCTGCTGCTGAACCAGGTGAGGAGGGAGAGTAAAGACCACGCCACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44583
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014897 Nonsense 242 1035 6 20
ENSDART00000048707 Nonsense 242 1071 6 22
Genomic Location (Zv9):
Chromosome 4 (position 8384912)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9312420
GRCz11 4 9313336
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAAGTACTCGGAGAACAAACTGAAGGTTATGAAAGCACGGAACGAGTA[T/A]CTGTTGACCCTGGAGGCCACGAACGCTTCTCTATTTAAATATTACATCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14806
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014897 Nonsense 257 1035 6 20
ENSDART00000048707 Nonsense 257 1071 6 22
Genomic Location (Zv9):
Chromosome 4 (position 8384957)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9312465
GRCz11 4 9313381
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTATCTGTTGACCCTGGAGGCCACGAACGCTTCTYTATTTMAATATTA[C/A]ATCCACGACCTGTCGCATCTGACTGACGTGAGTATCTGACTGTGAATCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link