avpr1b

Ensembl ID:
ENSDARG00000045788
ZFIN ID:
ZDB-GENE-041210-105
Description:
Novel protein similar to vertebrate arginine vasopressin receptor 1A (AVPR1A) [Source:UniProtKB/TrEM
Human Orthologue:
AVPR1A
Human Description:
arginine vasopressin receptor 1A [Source:HGNC Symbol;Acc:895]
Mouse Orthologue:
Avpr1a
Mouse Description:
arginine vasopressin receptor 1A Gene [Source:MGI Symbol;Acc:MGI:1859216]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33388 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33388
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067309 Nonsense 250 410 1 2
ENSDART00000142838 Nonsense 253 413 1 2
Genomic Location (Zv9):
Chromosome 4 (position 8284219)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9211727
GRCz11 4 9212643
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGCGGGATGATCGGAAAGGCGTCCGTCAGCAGCGTCACCATCATCTCC[A/T]GAGCCAAACTGCGCACGGTCAAGATGACCTTCGTGATTGTTTTGGCGTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link