zff9

Ensembl ID:
ENSDARG00000045776
ZFIN ID:
ZDB-GENE-030131-5045
Description:
zinc finger protein 9 [Source:RefSeq peptide;Acc:NP_956043]
Human Orthologues:
CNBP, ZCCHC13
Human Descriptions:
CCHC-type zinc finger, nucleic acid binding protein [Source:HGNC Symbol;Acc:13164]
zinc finger, CCHC domain containing 13 [Source:HGNC Symbol;Acc:31749]
Mouse Orthologues:
Cnbp, Zcchc13
Mouse Descriptions:
cellular nucleic acid binding protein Gene [Source:MGI Symbol;Acc:MGI:88431]
zinc finger, CCHC domain containing 13 Gene [Source:MGI Symbol;Acc:MGI:1922314]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37604 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37604
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067293 Nonsense 160 163 5 5
ENSDART00000125129 Nonsense 160 163 5 5
ENSDART00000129050 Nonsense 160 163 5 5
ENSDART00000136399 Nonsense 160 163 5 5
ENSDART00000144536   None 124 None 4
Genomic Location (Zv9):
Chromosome 23 (position 4754610)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 4764198
GRCz11 23 4700071
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGCTACAACTGCGGCAAGACCGGTCATCTGGCGAGAGACTGCAGCATC[G/T]AAGCGTCTGCGTAGCTCCTTTTCCTCTGTCACTTCCTCCTTTCCTGATTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link