zgc:162634

Ensembl ID:
ENSDARG00000045773
ZFIN ID:
ZDB-GENE-050506-109
Description:
hypothetical protein LOC555881 [Source:RefSeq peptide;Acc:NP_001082841]
Human Orthologue:
PIGY
Human Description:
phosphatidylinositol glycan anchor biosynthesis, class Y [Source:HGNC Symbol;Acc:28213]
Mouse Orthologue:
Pigy
Mouse Description:
phosphatidylinositol glycan anchor biosynthesis, class Y Gene [Source:MGI Symbol;Acc:MGI:1913709]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3312 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa3312
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067290   None 110 2 2
ENSDART00000144484 Nonsense 54 71 1 1
ENSDART00000067290   None 110 2 2
ENSDART00000144484 Nonsense 54 71 1 1
Genomic Location (Zv9):
Chromosome 25 (position 18336674)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17752984
GRCz11 25 17849384
KASP Assay ID:
554-3276.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGCATCTGTTTTTACAGCCTGCTTTTGCCCGTAACTATTCCTGTGTA[T/G]GTGTTTTTTCACCTTTGGAAGTGGATGGGAATCAAATTATTTAGACACAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: A genome-wide association study of seasonal pattern mania identifies NF1A as a possible susceptibility gene for bipolar disorder. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link